Query= gb|J04447.1|HUMTHROMP:1533-2033 Human thrombospondin gene, exons 1 and 2. of the human TS genomic clone Cos 22 (501 letters) >gi|201999:2670-3170 Mus musculus THBS1 gene, partial sequence Length = 501 Score = 48.1 bits (24), Expect = 8e-10 Identities = 45/52 (86%) Strand = Plus / Plus Query: 265 cgccaaggctgcgtgggcgggcaccgacttttctgagaagttctagtgctcc 316 |||||||||||||||||||| ||| | |||||||| |||||| || ||||| Sbjct: 278 cgccaaggctgcgtgggcggagacctatttttctgacaagttccagggctcc 329 Score = 34.2 bits (17), Expect = 1e-05 Identities = 45/53 (84%), Gaps = 1/53 (1%) Strand = Plus / Plus Query: 333 cccccttcactttctagctggaaagttgcgcgccaggcagcggggggcggaga 385 |||||||||||||| ||| || || || |||||| ||||| ||||||||||| Sbjct: 348 cccccttcactttc-agcccgagagctgtgcgccaagcagcagggggcggaga 399 Score = 26.3 bits (13), Expect = 0.003 Identities = 16/17 (94%) Strand = Plus / Plus Query: 321 ccccgacccccgccccc 337 ||||| ||||||||||| Sbjct: 415 ccccgtcccccgccccc 431 Score = 22.3 bits (11), Expect = 0.047 Identities = 11/11 (100%) Strand = Plus / Minus Query: 386 gaggagcccag 396 ||||||||||| Sbjct: 490 gaggagcccag 480 Score = 22.3 bits (11), Expect = 0.047 Identities = 11/11 (100%) Strand = Plus / Plus Query: 327 cccccgccccc 337 ||||||||||| Sbjct: 427 cccccgccccc 437 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 6 Number of Sequences: 0 Number of extensions: 6 Number of successful extensions: 6 Number of sequences better than 10.0: 1 Number of HSP's better than 10.0 without gapping: 1 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 0 Number of HSP's gapped (non-prelim): 5 length of query: 501 length of database: 501 effective HSP length: 9 effective length of query: 492 effective length of database: 492 effective search space: 242064 effective search space used: 242064 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 8 (16.4 bits)