Query= gi|339817:3031-3531 Human tissue plasminogen activator (PLAT) gene, complete cds (501 letters) >gb|M26065.1|MUSPAP:247-747 Mouse tissue plasminogen activator gene, 5' flank Length = 501 Score = 34.2 bits (17), Expect = 1e-05 Identities = 35/41 (85%) Strand = Plus / Plus Query: 371 aaattcctgcgattcaatgacatcacggctgtgaataatca 411 ||||||||| ||||| ||||||||| | ||||||||||| Sbjct: 312 aaattcctgtgattcgatgacatcagtacggtgaataatca 352 Score = 26.3 bits (13), Expect = 0.003 Identities = 13/13 (100%) Strand = Plus / Plus Query: 455 acttcctccccct 467 ||||||||||||| Sbjct: 394 acttcctccccct 406 Score = 24.3 bits (12), Expect = 0.012 Identities = 12/12 (100%) Strand = Plus / Plus Query: 222 attccagaagac 233 |||||||||||| Sbjct: 147 attccagaagac 158 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3 Number of Sequences: 0 Number of extensions: 3 Number of successful extensions: 3 Number of sequences better than 10.0: 1 Number of HSP's better than 10.0 without gapping: 1 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 0 Number of HSP's gapped (non-prelim): 3 length of query: 501 length of database: 501 effective HSP length: 9 effective length of query: 492 effective length of database: 492 effective search space: 242064 effective search space used: 242064 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 8 (16.4 bits)